Genetic Drift

by Full Deck

0:00

by Full Deck · Indigestion

CASE 1158

Genetic Drift

by Full Deck

Indigestion
  • Kropki dots
  • Kropki difference

The brief

Normal sudoku rules apply but cloning has gone horribly wrong. Four different gene cages (indicated by A, C, G, or T in the upper left corner) have replicated across the grid with mutations. Each copy of the original gene contains only digits from the original but order, orientation, and cage size may vary. Every copy of each gene (and its mutations) is indicated in the grid. For example, if gene A is 1-2, then every place that 1 is orthogonally adjacent to 2 in the grid will be marked with a gene cage labeled A. Bonds, indicated by white Kropki dots, have formed where two different genes have adjacent consecutive digits. All consecutive pair bonds between genes are indicated but there may be unmarked consecutive pairs within or outside gene cages.

AGCTTCTTTGAGCTGGACAA28579